Research and Development on Lentivectors for:
Design of efficient microRNA
Until now, it seems that nobody really tried to optimize the design of miRNAs to achieve maximum efficiency. There was 2 main reasons for this.
First, laziness. Why try to understand what really matters in miRNA processing and efficiency if you do not need it because your experimental settings are not concerned by efficiency.
Second, no need for it. If you are not working on clinically-relevant projects, i.e. trying to combine efficacy and safety to reach a compromise that can be translated into a cure, you do not need to optimize your molecular tools. You just add more vectors to your cell lines and you can publish.
Now, if you need to downregulate a gene to less than 10% of its expression to achieve a phenotype, but with only one or two copies of a viral vector, because you do not want to pile up copies of foreign DNA in the genome of the patient's cells, then you need to go back to the drawing board.
That is what we have done when trying to render human cells resistant to HIV by suppressing expression of its co-receptor, CCR5. Since no currently available design was efficient enough for our purpose, we had to go back to the basics, and develop a new miRNA design (mirGE) from what we understood of the mechanistics of miRNA-based silencing.
We provide here the recipe for everybody to achieve maximum efficiency in gene knockdown.
Oligos
5' oligo for PCR amplication of the mirGE hairpin
5’-cagaaggggatccATCGATactagtGGTGATAGCAATGTCAGCAGT
The sequence annealing to mirGE template is underlined. The sequences for restriction sites BamHI and SpeI are in bold lower case.
3' oligo for PCR amplication of the mirGE hairpin
5’-AGTAGCTtctagaGTAGAGTATGGTCAACCTT
The sequences annealing to miR-30 or mirGE templates are underlined. The sequence for restriction site XbaI is in bold lower case.
template oligo containing the hairpin
5’-GGTGATAGCAATGTCAGCAGTGCCTNNNNNNNNNNNNNNNNNNNNNNGTGAAGCCACAGATGNNNNNNNNNNNNNNNNNNNNNNAAGTAAGGTTGACCATACTCTAC
Sequences are shown as you must order them, ready to serve as template to PCR amplify with the corresponding primers shown above. Targeting strand is in YELLOW, passenger strand is in RED.
Algorithm
5’-ATTGATACTGACTGTATGGAAA
3’-ZAACTATGACTGACATACCTTT
5’- NNNNNNNNNNNNNNNNNNNNNN
3’- ZNNNNNNNNNNZNNNNNNNNNN
References:
Plasmids and cloning
Once you have your mirGE PCR band (amplicon), purify it and cut it with BamHI and XbaI and ligate into a pENTR-deltaGFP-mirGE plasmid as described below (pENTRdeltaGFP-mirGE-DroshaT115).
If you want to add more hairpins, just cut the pENTR plasmid already having hairpin (s) with BamHI and SpeI and ligate your new hairpin inside.
For example, you can open the pENTRdeltaGFP-mirGE-DroshaT115 (available from Addgene) with BamHI and XbaI. Purify and keep the plasmid band (3000 bp) from the insert band (approx 360 bp, i.e. 3 loops), and use it to ligate your own mirGE amplicon into it. pENTRdeltaGFP has 3 stop codons in the GFP ORF to kill GFP translation. So GFP ORF is used as a spacer between the 5' cap and the mirGE stems.
Sequence the insert after each insertion step. Once you have your final pENTR-deltaGFP-mirGExxx plasmid, you can do a LR reaction with any of the LentiDEST plasmids we have deposited at Addgene.
For example, once you have your pENTR-mirGE with the desired number of correct hairpins, you can do a LR reaction with pCWX-R4-DEST-R2-PG and pENTR-UBI, to have a final lenti plasmid expressing your mirGE from the UBI promoter and GFP from the PGK promoter. In that case, the GIO is deltaGFP-mirGExxx, and PRO is Ubiquitin promoter.