Research and Development on Lentivectors for:

ADDGENEUNITEC

Dr Patrick SALMON @ Department of Neurosciences - Faculty of Medicine - University of Geneva

Lentiviral Vectors Lab @ UNIGE

Mycoplasma Assay

This method is used to detect mycoplasma in DNA or culture supernatant from cells.


It is cheap, sensitive, reliable and the primers used can detect most strains of mycoplasma.


 


To extract DNA, you can use 1 to 2 millions cells, extracted with a Qiagen DNAeasy kit. Use 1 µl of sample from a 100 µl extract.


If you want to use supernatant, harvest 100 µl of cell culture medium that was in contact with cells for at least 2 consecutive days (3 is best), incubate at 95°C for 5 min and store at -20°C. Note that you cannot use L32 primers as internal control when you use culture supernatants.


L32 primers are from Homo sapiens ribosomal protein L32 pseudogene (Genbank NG_021756)



The PCR mix is as follows:



Red Taq mix 2x                   7.5 µl

Primer mix 10µM                 0.3 µl

H2O                                       6.2 µl

DNA                                         1 µl


Where the primer mix is either MYCO or L32 (internal control).



Primers MYCO


Fwd 5’- GGCGAATGGGTGAGTAACACG


Rev 5’- CGGATAACGCTTGCGACCTAT


Amplicon approx. 500 bp




Primers L-32


Fwd 5’- GTGAAGCCCAAGATCGTCAA


Rev 5’- TTGGTGACTCTGATGGCCAG


Amplicon approx. 400 bp



The PCR program is as follows:


Step 1 - 95°C – 5 min


Step 2 – 95°C – 20 sec


Step 3 – 55°C – 1 min


Step 4 – 72°C – 1 min – from 2 to 4, 32 cycles


Step 5 – 72°C – 10 min


Step 6 – 4°C pause