Research and Development on Lentivectors for:

ADDGENEUNITEC

Dr Patrick SALMON @ Department of Neurosciences - Faculty of Medicine - University of Geneva

Lentiviral Vectors Lab @ UNIGE

Lentivector titration by quantitative PCR (qPCR)


2011GiryLaterriere MiMB.pdf

In the case of vectors coding for genes that can not be readily detected by FACS, or if the promoter is not active in Hela cells, an alternative method is to measure the number of copies of LV stably integrated in Hela target cells, after transduction as described above for GFP vectors. This assay, however, only measures the number of LV copies integrated in the target cell genome. The overall functionality of the vector must be tested at least once in cells in which the promoter is active and/or with appropriate techniques to detect the expression of the transgene product.

The qPCR assay proceeds as follows, using a 7700 Sequence Detector (Applied Biosystems).


Hela cells are transduced as for FACS titration, but instead of being detached by trypsin, they are lyzed with 200µl of lysis buffer in the plate and the DNA is extracted using a DNAeasy kit (Qiagen GmbH, Germany). Then, 1-2 µl of 200 µl total of DNA solution is analyzed for copy number of HIV sequences using the following real-time PCR protocol.


Reaction


    Always use filter-tips. Mix for each sample and distribute in duplicate in 96-well Optical Reaction plate (Cat# 4306737, Applied Biosystems):

    2x mix  12.5 µl  (Cat# RT-QP2X-03 Eurogentec, Belgium)

    10x oligo mix1  2.5 µl   

    10x oligo mix2  2.5 µl   

    DNA sample  1-2µl   

    H2O   up to 25 µl   


    Close with Optical caps (Cat# N801-0935, Applied Biosystems)


    Run a program appropriate for the probes, depending on the fluochrome used (FAM, VIC or Yakima Yellow, etc).


    Notes:


    Standard concentrations in 10x oligo mixes are 1 µM probe and 3 µM of each primer in water. However, these concentrations may vary when using 2 sets (or more) of Oligo sets simultaneously (Multiplex Analysis). For multiplex analysis using HB2 and GAG oligosets, HB2 primers are used at 20 nM final.


    Stocks of probes and primers usually come lyophilyzed and are stored at 10 µM in water


    DNA ideally comes from 2x106 Hela cells extracted and resuspended in 100 µl of Buffer AE (DNAeasy Tissue Kit, Cat. 69504, Qiagen)


Oligos


    Oligos can be ordered on-line from several companies such as Eurogentec.


    Oligos used to normalize for the amount of genomic DNA are specific for the human beta-actin gene.


        HB2-P (probe, sense) human beta-actin, Genbank M10277, exon 5, nt.2884-2952.


        5'-(Yakima Yellow)- CCTGGCCTCGCTGTCCACCTTCCA -(Eclipse Dark Quencher)-3'


        HB2-F (forward primer)            TCCGTGTGGATCGGCGGCTCCA


        HB2-R (reverse primer)            CTGCTTGCTGATCCACATCTG


        Oligos for amplification of HIV-1 derived vectors are specific for the 5' end of the gag gene (GAG). This sequence is present in all HIV-1 vectors for it is part of the extended packaging signal.


        GAG-P (probe, antisense) HIV gag


        5'-(FAM)- ACAGCCTTCTGATGTTTCTAACAGGCCAGG -(Eclipse Dark Quencher)-3'


        GAG-F (forward primer)            GGAGCTAGAACGATTCGCAGTTA


        GAG-R (reverse primer)            GGTTGTAGCTGTCCCAGTATTTGTC


Analysis


    An example of amplification profiles of HIV sequences in human DNA is given below (as displayed by the ABI Prism™ program, Applied Biosystems). To analyze the amplification reaction, first set the threshold were the amplification curve is the steepest, both for the gene of interest (GAG-FAM)












    

















and for the internal control (HB2-YY).






















    







Then, export the results in a Microsoft Excel sheet and draw a standard curve





















    




with standards of cells containing known copy numbers of HIV per cell, using the deltaCt values (Ct GAG minus Ct HB2). Ask Excel to display the formula (exponential). Apply the formula to unknown samples, it will give the HIV copy number of the corresponding sample. The titer of the supernatant can then be calculated as follows:


    Titer (Hela-transducing units / ml) = 100000 (target Hela cells) x number of copy per cell of the sample / volume of supernatant (in ml).


    Alternatively, normalization for DNA content can be made by separate determination of beta-actin copy number and HIV copy number.


    Notes :


    Standards of cells containing 10, 1, 0.1 and 0.01 copy of LV per cell can be prepared from Hela cells transduced with a GFP vector, using serial 10-fold dilutions. The 0.1 copy per cell standard will be provided by the sample displaying 10% of GFP-positive cells. It is advisory to run a dual titration (FACS plus TAQMAN) using one GFP vector alongside the other vectors, for each experiment of qPCR titration. This will help comparing the FACS titration with the QPCR titration. Normalization for DNA content can also be made by separate determination of beta-actin copy number and HIV copy number. This will however require to double the total number of wells used for the whole QPCR assay. Using standard DNA extraction procedures in a laboratory context where HIV sequences are often handled, you can expect a level of background contamination with HIV sequences corresponding to cells containing 1 copy per 1000 genomes. In this case, consider higher copy numbers for calibration. Vector stocks failing to give higher than 0.01 copy per genome in a QPCR assay, have an infectivity index that renders them unusable for most applications (see INFECTIVITY INDEX). Using careful DNA extraction procedures and standardization as described above, you can expect a reproducibility within a 2-fold range. Ask your local QPCR expert if you need a more stringent quantitation QPCR procedure.


    The standard curve can also be made by diluting DNA from cells containing a known number of copies of integrated HIV target sequences, into DNA from their parental cell line. As shown above, this can be done using 8E5, a derivative of CEM cells, and CEM parental cells. It can also be done using 4.5 cells and Hela cells. In this latter case, the standard curve will be made with the same cells as the target cells used for titration. The 4.5 cells were obtained as follows. Hela cells were transduced using pLOX-gfp vector at a MOI of 0.2. GFP-positive cells and were then sorted and cloned by limiting dilution. Several GFP-positive clones were selected and one (clone 4.5) was retained as a reference for GFP expression from an excisable HIV-based vector (cf Salmon et al, 2000, Mol. Ther.). This 4.5 clone was further analyzed for copy number using QPCR and 8E5 cells are reference, and have been found to have one copy of HIV target sequence.