Research and Development on Lentivectors for:

ADDGENEUNITEC

Dr Patrick SALMON @ Department of Neurosciences - Faculty of Medicine - University of Geneva

Lentiviral Vectors Lab @ UNIGE

Replication-Competent Recombinant (RCR) Assay

Background


The absence of Replication-Competent Recombinants is essential to downgrade cells that have been transduced by retroviral vectors, including LVs.


We use a test based on the detection (or absence of detection) in the chromosomal DNA of transduced cells, of HIV sequences that are absent in the transfer plasmid (vector genome) but are present in the packaging plasmid and are essential for HIV (or RCR) replication. The target sequence chosen in our assay is located in the sequence coding for the reverse transcriptase.


Method


DNA (1 µl corresponding to 104 cells) is analyzed for copy number of HIV sequences using the following real-time PCR protocol.


The reaction is performed in duplicate in 96-well Optical Reaction plate (ref 4306737, Applied Biosystems) in 25 µl final comprising:


    reaction 2x mix (12.5 µl, Ref. RT-QP2X-03 Eurogentech, Belgium)


    GAG or POL oligo mix


    beta-actin oligo mix (internal genomic control)


Amplification plots were analyzed over 50 cycles on a 7700 Sequence Detector (Perkin-Elmer). Oligos for amplification of sequences present in all HIV-1 derived vectors are specific for the 5' end of the gag gene (GAG). This sequence is present in all HIV-1 vectors.


Sequences are:


    GAG-P (probe, antisense)


    5'-(FAM)-ACAGCCTTCTGATGTTTCTAACAGGCCAGG-(TAMRA)-3'


    GAG-F (forward primer)


    5’-GGAGCTAGAACGATTCGCAGTTA


    GAG-R (reverse primer)


    5’-GGTTGTAGCTGTCCCAGTATTTGTC


Oligos for amplification of sequences present in RCRs are specific for the region of the pol gene coding for the reverse transcriptase (POL).


Sequences are:


    POL-P (probe, sense) 5'-(FAM)-TGGACAGTACAGCCTATAGTGCTGCCAGAAA-(TAMRA)-3’


    POL-F (forward primer) 5’-TTCCTTTGGATGGGTTATGAACTC


    POL-R (reverse primer) 5’-GTATGTCATTGACAGTCCAGCTGTC.


Oligos used to normalize for the amount of genomic DNA are specific for the beta-actin (BAC) gene. The sequences are originally from a PE-Applied TAQMAN beta-actin control reagent (Cat 401846) which has been discontinued.


Sequences are:


    HB2-P (probe, sense) human beta-actin, Genbank M10277, exon 5, nt.2884-2952.


    5'-(Yakima Yellow)- CCTGGCCTCGCTGTCCACCTTCCA -(Eclipse Dark Quencher)-3'


    HB2-F (forward primer)            TCCGTGTGGATCGGCGGCTCCA


    HB2-R (reverse primer)            CTGCTTGCTGATCCACATCTG


Analysis is performed basically as described in QPCR titration. In this case, however, you need 2 types of standards. One standard corresponds to cells containing vector sequences only (LV standard, target for GAG oligo set), and one corresponds to cells containing all HIV sequences (HIV standard, target for GAG and POL oligo sets). The first is provided by cells transduced with classical LV. The second is provided by cells having one copy of full-length HIV genome, such as 8E5 cells. In the case of 8E5, the DNA will contain 1 copy of HIV per genome. Serial 10-fold dilutions of 8E5 DNA into human DNA (up to 10-3 copy per genome) can be performed to provide a HIV-DNA standard curve. A negative control both for LV sequences and HIV sequences will be provided by Hela cells. Results are expressed as deltaCt values for each oligo set, i.e. GAG-HB2 deltaCt and POL-HB2 deltaCt. The sample DNA will be considered negative for POL sequences, hence RCR, if its POL-HB2 deltaCt value is similar to the POL-HB2 deltaCt value of Hela cells, with a GAG-HB2 deltaCt value above the range corresponding to 1 copy of LV sequence per genome.



Notes:


Cells analyzed for the absence of RCR must be confined cells in a culture flask with vented cap until result of RCR analysis. If the result is negative, cells can be downgraded. Spraying the flask with 75% ethanol and transfer it outside of the culture laboratory. Other RCR tests have been described in the literature. One recent paper describes a true RCR assay which failed to detect any RCR in vector batches produced from 3rd generation packaging systems (Escarpe, Zayek et al. 2003). Other tests have been described but they detect biological entities that need trans-complementation to replicate. Although these assays can measure the level of recombination during the production of lentivectors, they are not suitable to detect genuine RCR that may represent a biological hazard by dissemination within primary human cells. ATCC recommends that 8E5 are handled in P2 laboratory. Indeed, although they contain a full copy of non-infectious HIV, they can form syncitia with uninfected CD4+ cells.